Skip to another splice site:
1  
 5'  3'   		2  
 5'  3'   		3  
 5'  3'   		4  
 5'  3'   		5  
 5'  3'   		6  
 5'  3'   		7  
 5'  3'   		8  
 5'  3'   		9  
 5'  3'   

Data associated with selected splice site

Sequence

 atgc   intronic sequence     ATGC   exonic sequence

...ttggtgactcttgctaaaatttaaatgaccatttgtacctaactttattttctcaaacttgtgaatgacatgtattttttattattttttgattttgcagCTGGACATCGATTTAGTTTGGTCTGACATAAAGAACTTAAATCTGAAAG

Basic information

species Zea mays
transcript GRMZM2G113640_T01
intron # 5
splice site 3'
intron type U2

Mapped EST sequences

Showing partial alignments of ESTs and genomic sequences. See full alignments


 ATGC     EST sequence
 ATGC     genomic sequence (exon)
 ATGC     genomic sequence (truncated intron)


EST: gi|211270654|gb|FL248444.1|FL248444
EST:     G
genomic: T
EST: gi|71438832|gb|DR819882.1|DR819882
EST:     G
genomic: T
EST: gi|211270652|gb|FL248442.1|FL248442
EST:     G
genomic: T
EST: gi|211270657|gb|FL248447.1|FL248447
EST:     G
genomic: T
EST: gi|211270656|gb|FL248446.1|FL248446
EST:     G
genomic: T
EST: gi|76012002|gb|DT939172.1|DT939172
EST:     G
genomic: T
EST: gi|211270651|gb|FL248441.1|FL248441
EST:     G
genomic: T
EST: gi|211270648|gb|FL248438.1|FL248438
EST:     G
genomic: T
EST: gi|6227108|gb|AW155812.1|AW155812
EST:     ACAGTCACTTGAACTTGCTCAAGAAAATGCTGCTGATCTGGAG        
genomic: AC-TGAAAATGCTGCTGATCTGGAGgtatgacaat ... gattttgcagC
EST: gi|50327796|gb|CO522922.1|CO522922
EST:     G
genomic: T
EST: gi|211270649|gb|FL248439.1|FL248439
EST:     G
genomic: T
EST: gi|211270655|gb|FL248445.1|FL248445
EST:     G
genomic: T


 atgc   intronic sequence     ATGC   exonic sequence

Intronic sequence truncated to 55 bases.

tattttctcaaacttgtgaatgacatgtattttttattattttttgattttgcagCTGGACATCGATTTAGTTTGGTCTGACATAAAGAACTTAAATCTGAAAG
                                         ttttgat  putative branch site (score: 4)
                                       ttttttg  CT-rich tract
                tgaatgacatgtattt  TA-rich tract
















Putative cis-regulatory sequences

 atgc intron ATGC exonic elements by Pertea et al.
 ATGC exon atgc putative intronic elements
 ATGC putative exonic elements identified for retained introns
        10        20        30        40        50        60        70        80        90        100       110       120       130       140       150       160       170       180       190       200       210       220 
---------|---------|---------|---------|---------|---------|---------|---------|---------|---------|---------|---------|---------|---------|---------|---------|---------|---------|---------|---------|---------|---------| 
ttggtgactcttgctaaaatttaaatgaccatttgtacctaactttattttctcaaacttgtgaatgacatgtattttttattattttttgattttgcagCTGGACATCGATTTAGTTTGGTCTGACATAAAGAACTTAAATCTGAAAG

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -  AAAGAA
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - AAGAAC