name |
mature homolog |
mature |
mature status |
target |
best UniProt hit |
expectation |
UPE |
miRNA start-end |
target start-end |
inhibition |
miRNA:target duplex |
---|---|---|---|---|---|---|---|---|---|---|---|
mdm-MIR117N | zma-miR319a-5p | GAGCTTTCTTCAGTCCACTC | CONSERVED | TC94787 | no hits with E-value < 1e-10 | 3 | 20.841 | 1 - 20 | 183 - 202 | Translation | CTCACCTGACTTCTTTCGAG |
mdm-MIR117N | zma-miR319a-5p | GAGCTTTCTTCAGTCCACTC | CONSERVED | TC91646 | no hits with E-value < 1e-10 | 3 | 18.903 | 1 - 20 | 311 - 330 | Cleavage | CTCACCTGACTTCTTTCGAG |
mdm-MIR117N | zma-miR319a-5p | GAGCTTTCTTCAGTCCACTC | CONSERVED | MDP0000538670 | Pre-mRNA-processing factor 6 E-value: 0.0 more |
2 | 20.305 | 1 - 20 | 2499 - 2518 | Cleavage | CTCACCTGACTTCTTTCGAG |
mdm-MIR117N | zma-miR319a-5p | GAGCTTTCTTCAGTCCACTC | CONSERVED | MDP0000506415 | Centromere/kinetochore protein zw10 homolog E-value: 7e-54 more |
2.5 | 21.07 | 1 - 20 | 684 - 703 | Cleavage | CTCACCTGACTTCTTTCGAG |
mdm-MIR117N | zma-miR319a-5p | GAGCTTTCTTCAGTCCACTC | CONSERVED | MDP0000415728 | Centromere/kinetochore protein zw10 homolog E-value: 9e-60 more |
2.5 | 19.575 | 1 - 20 | 750 - 769 | Cleavage | CTCACCTGACTTCTTTCGAG |
mdm-MIR117N | zma-miR319a-5p | GAGCTTTCTTCAGTCCACTC | CONSERVED | MDP0000468056 | Centromere/kinetochore protein zw10 homolog E-value: 2e-132 more |
2.5 | 24.443 | 1 - 20 | 2631 - 2650 | Cleavage | CTCACCTGACTTCTTTCGAG |
mdm-MIR117N | zma-miR319a-5p | GAGCTTTCTTCAGTCCACTC | CONSERVED | MDP0000427095 | Cysteine-rich repeat secretory protein 3 E-value: 1e-65 more |
3 | 15.508 | 1 - 20 | 577 - 596 | Translation | CTCACCTGACTTCTTTCGAG |
mdm-MIR117N | zma-miR319a-5p | GAGCTTTCTTCAGTCCACTC | CONSERVED | MDP0000216803 | Cysteine-rich repeat secretory protein 3 E-value: 2e-101 more |
3 | 15.508 | 1 - 20 | 936 - 955 | Translation | CTCACCTGACTTCTTTCGAG |
mdm-MIR117N | zma-miR319a-5p | GAGCTTTCTTCAGTCCACTC | CONSERVED | MDP0000253714 | Cysteine-rich repeat secretory protein 3 E-value: 2e-101 more |
3 | 20.841 | 1 - 20 | 933 - 952 | Translation | CTCACCTGACTTCTTTCGAG |